ID: 992529281_992529294

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 992529281 992529294
Species Human (GRCh38) Human (GRCh38)
Location 5:77639292-77639314 5:77639343-77639365
Sequence CCCCACAGTGGGCCTAGAGCGCA AGCGCCCGCTGTCTGCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82} {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!