ID: 992531913_992531919

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 992531913 992531919
Species Human (GRCh38) Human (GRCh38)
Location 5:77660116-77660138 5:77660166-77660188
Sequence CCCACAATCACTGCACTTTCCCT TGTCATGCAGCCACTGCTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 75, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!