ID: 992560462_992560465

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 992560462 992560465
Species Human (GRCh38) Human (GRCh38)
Location 5:77947462-77947484 5:77947480-77947502
Sequence CCACTTGGATTTGAAAACAAATA AAATATAAGCAAAAATTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 82, 4: 1086}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!