ID: 992562793_992562805

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 992562793 992562805
Species Human (GRCh38) Human (GRCh38)
Location 5:77968949-77968971 5:77968987-77969009
Sequence CCGAGCATGGTGGCTCATGCCTG GGGAGACCAGGGGTTGGGGCGGG
Strand - +
Off-target summary {0: 451, 1: 10455, 2: 44604, 3: 107737, 4: 180085} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!