ID: 992616184_992616187

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 992616184 992616187
Species Human (GRCh38) Human (GRCh38)
Location 5:78548219-78548241 5:78548255-78548277
Sequence CCTCCCAGCTACGGTACATAAGC TCCACGTAAAGAGCTCCACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32} {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!