ID: 992654437_992654440

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992654437 992654440
Species Human (GRCh38) Human (GRCh38)
Location 5:78894521-78894543 5:78894549-78894571
Sequence CCAGATTCTAAAGGATCTCACTG TGGGTGTTTAATGCAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135} {0: 1, 1: 0, 2: 0, 3: 19, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!