ID: 992656574_992656581

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 992656574 992656581
Species Human (GRCh38) Human (GRCh38)
Location 5:78916303-78916325 5:78916328-78916350
Sequence CCCAGAAATCTTCCCTGGCCTGT CAGTCCAGAAGAAAGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 16, 4: 271} {0: 1, 1: 1, 2: 0, 3: 37, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!