ID: 992656725_992656733

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 992656725 992656733
Species Human (GRCh38) Human (GRCh38)
Location 5:78917807-78917829 5:78917837-78917859
Sequence CCAGCCTGCAGTTATGTTTAAAG ATTAAACCACAGGTTCAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 274} {0: 1, 1: 0, 2: 0, 3: 120, 4: 6223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!