ID: 992678328_992678335

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992678328 992678335
Species Human (GRCh38) Human (GRCh38)
Location 5:79127891-79127913 5:79127919-79127941
Sequence CCCAGAAAGGGGCTTTTTGCCAC TCAGAAAAACATGGCAGCTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 143} {0: 1, 1: 1, 2: 5, 3: 29, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!