ID: 992681845_992681847

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 992681845 992681847
Species Human (GRCh38) Human (GRCh38)
Location 5:79161289-79161311 5:79161327-79161349
Sequence CCAAGCACAGAAAGACATGATCA ATGTAGGAGCTGAAAAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 264} {0: 1, 1: 0, 2: 8, 3: 50, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!