ID: 992744597_992744598

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 992744597 992744598
Species Human (GRCh38) Human (GRCh38)
Location 5:79806740-79806762 5:79806754-79806776
Sequence CCAGTGTTTGGGTATCATGTTTT TCATGTTTTTCAATATCAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 51, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!