ID: 992813054_992813061

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 992813054 992813061
Species Human (GRCh38) Human (GRCh38)
Location 5:80408323-80408345 5:80408350-80408372
Sequence CCGGGGAACCCTGGCCCTCCAAT TGTCCCCTCCTGGAGCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167} {0: 1, 1: 0, 2: 2, 3: 27, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!