ID: 992813058_992813077

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 992813058 992813077
Species Human (GRCh38) Human (GRCh38)
Location 5:80408338-80408360 5:80408387-80408409
Sequence CCTCCAATCTGATGTCCCCTCCT GACCGGGAGGGCAATCACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 251} {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!