ID: 992880534_992880537

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 992880534 992880537
Species Human (GRCh38) Human (GRCh38)
Location 5:81105107-81105129 5:81105121-81105143
Sequence CCCAGAGAACTGCATCTTAAGAT TCTTAAGATACCCTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 190} {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!