ID: 992885396_992885398

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 992885396 992885398
Species Human (GRCh38) Human (GRCh38)
Location 5:81153935-81153957 5:81153972-81153994
Sequence CCAAAAAAAAAAAAAAACTTATT GTGTTTTATAATGAAAACACAGG
Strand - +
Off-target summary {0: 1, 1: 56, 2: 430, 3: 2906, 4: 12145} {0: 1, 1: 0, 2: 7, 3: 46, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!