ID: 992885508_992885515

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 992885508 992885515
Species Human (GRCh38) Human (GRCh38)
Location 5:81155631-81155653 5:81155655-81155677
Sequence CCCATAAGGAGCTACCCCAGACC TCCTGATATAGAAGCTGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91} {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!