|
Left Crispr |
Right Crispr |
| Crispr ID |
992890091 |
992890096 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:81195979-81196001
|
5:81196009-81196031
|
| Sequence |
CCGGGCACCGTGGCTCACGCGTG |
AGCACTTTGGGAGGCCAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 368, 2: 21176, 3: 92576, 4: 136440} |
{0: 3853, 1: 66063, 2: 153594, 3: 157369, 4: 93226} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|