ID: 992890091_992890099

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 992890091 992890099
Species Human (GRCh38) Human (GRCh38)
Location 5:81195979-81196001 5:81196029-81196051
Sequence CCGGGCACCGTGGCTCACGCGTG AGGGCAGATCATTTGAAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 368, 2: 21176, 3: 92576, 4: 136440} {0: 4, 1: 140, 2: 2239, 3: 16072, 4: 50521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!