ID: 992913819_992913822

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 992913819 992913822
Species Human (GRCh38) Human (GRCh38)
Location 5:81426749-81426771 5:81426771-81426793
Sequence CCCTCTTCCAACTGTTAAGACAG GCAGTCACTAATGACAAATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!