ID: 992983013_992983018

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 992983013 992983018
Species Human (GRCh38) Human (GRCh38)
Location 5:82196654-82196676 5:82196698-82196720
Sequence CCCACTTAATTATCTTGGCACCC TAGATGTATGCATTTATTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 108, 2: 447, 3: 1320, 4: 3519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!