ID: 992995106_992995112

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 992995106 992995112
Species Human (GRCh38) Human (GRCh38)
Location 5:82324721-82324743 5:82324759-82324781
Sequence CCCCTTCTTGGGGGCGGGTGAGG TTCCTCAGAGGAGACACCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 225} {0: 1, 1: 0, 2: 3, 3: 52, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!