ID: 993010302_993010304

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 993010302 993010304
Species Human (GRCh38) Human (GRCh38)
Location 5:82474911-82474933 5:82474944-82474966
Sequence CCTTCAAATATTTGCATATAATT TATTTCCAAGACCCTTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 88, 4: 808} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!