ID: 993018296_993018302

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 993018296 993018302
Species Human (GRCh38) Human (GRCh38)
Location 5:82562222-82562244 5:82562254-82562276
Sequence CCACAAATTTGGTGGCCTAAAAC TTGTTATCTTATGGTTCTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 111, 3: 605, 4: 2249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!