ID: 993018717_993018725

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 993018717 993018725
Species Human (GRCh38) Human (GRCh38)
Location 5:82564837-82564859 5:82564869-82564891
Sequence CCCCCATCCTGTTGATTGCACTG TGACCTGCATTTCTCTGGGGTGG
Strand - +
Off-target summary No data {0: 4, 1: 19, 2: 55, 3: 101, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!