ID: 993020724_993020727

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 993020724 993020727
Species Human (GRCh38) Human (GRCh38)
Location 5:82587115-82587137 5:82587146-82587168
Sequence CCAAATACTACAGTACAGATGGA GCCTCATGCAGAAGCAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138} {0: 1, 1: 0, 2: 5, 3: 42, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!