ID: 993038039_993038045

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 993038039 993038045
Species Human (GRCh38) Human (GRCh38)
Location 5:82779163-82779185 5:82779200-82779222
Sequence CCAGACCCTTTCCTTAACTACAG TGTGAGAACTGACCCAAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!