ID: 993073841_993073852

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 993073841 993073852
Species Human (GRCh38) Human (GRCh38)
Location 5:83201382-83201404 5:83201420-83201442
Sequence CCCACTGGCCCCTAGTAAAATGC ACACCAAGTACAAGCTGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 1, 3: 12, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!