|
Left Crispr |
Right Crispr |
| Crispr ID |
993138245 |
993138253 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:83997793-83997815
|
5:83997828-83997850
|
| Sequence |
CCAAAAATCAGGTGAGTGATCAG |
AGGGAGAATGAAGTGATTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 51, 2: 116, 3: 230, 4: 566} |
{0: 1, 1: 6, 2: 40, 3: 119, 4: 482} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|