ID: 993159931_993159937

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 993159931 993159937
Species Human (GRCh38) Human (GRCh38)
Location 5:84277163-84277185 5:84277185-84277207
Sequence CCCCCCAAGATTCATATGTTGAA AATTTTAACCCCCAAGGCGATGG
Strand - +
Off-target summary {0: 4, 1: 201, 2: 1008, 3: 2226, 4: 3160} {0: 1, 1: 2, 2: 58, 3: 339, 4: 1690}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!