ID: 993159932_993159943

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 993159932 993159943
Species Human (GRCh38) Human (GRCh38)
Location 5:84277164-84277186 5:84277198-84277220
Sequence CCCCCAAGATTCATATGTTGAAA AAGGCGATGGTATTAAGAGGTGG
Strand - +
Off-target summary {0: 3, 1: 289, 2: 1258, 3: 2754, 4: 4242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!