ID: 993231900_993231904

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 993231900 993231904
Species Human (GRCh38) Human (GRCh38)
Location 5:85247524-85247546 5:85247562-85247584
Sequence CCAGTAACAGGCCAAGAGCTGTC AGTTTTCTGCAAAAGATGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 205, 3: 207, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!