ID: 993248789_993248792

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 993248789 993248792
Species Human (GRCh38) Human (GRCh38)
Location 5:85487644-85487666 5:85487669-85487691
Sequence CCTTCACTCTTCTGGAAGGGCAT TTTGTTGGGTTCTTTTTCCATGG
Strand - +
Off-target summary {0: 2, 1: 19, 2: 58, 3: 54, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!