ID: 993266087_993266089

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 993266087 993266089
Species Human (GRCh38) Human (GRCh38)
Location 5:85728168-85728190 5:85728198-85728220
Sequence CCCTTTATGAGGACATCTGTGAT TGAACCCGCATGAATAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 80, 4: 478} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!