ID: 993308976_993308983

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 993308976 993308983
Species Human (GRCh38) Human (GRCh38)
Location 5:86304387-86304409 5:86304410-86304432
Sequence CCAGGCAGTTTGGAAACCCAAGG AGGGAGGATTCCTTGAACCCAGG
Strand - +
Off-target summary No data {0: 4, 1: 97, 2: 2555, 3: 22021, 4: 107846}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!