ID: 993412581_993412584

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 993412581 993412584
Species Human (GRCh38) Human (GRCh38)
Location 5:87591803-87591825 5:87591837-87591859
Sequence CCAGTAACAGGCCAAGAGCTTCC GAGTAGTTATCTGCAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 184, 3: 204, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!