ID: 993449808_993449813

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 993449808 993449813
Species Human (GRCh38) Human (GRCh38)
Location 5:88059706-88059728 5:88059721-88059743
Sequence CCCTCAGGCCTGAATTGAGATGA TGAGATGATGGGCACCATACTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 9, 3: 13, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!