ID: 993480070_993480072

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 993480070 993480072
Species Human (GRCh38) Human (GRCh38)
Location 5:88413680-88413702 5:88413708-88413730
Sequence CCTCTCTTCCACATCTATTCTCT TCCTGTCGAAGTATGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 487} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!