ID: 993482938_993482947

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 993482938 993482947
Species Human (GRCh38) Human (GRCh38)
Location 5:88447673-88447695 5:88447713-88447735
Sequence CCACAGACCTTACCCTGGACCAG AGAAGATGAAAAGGAGGCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 96, 4: 899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!