ID: 993515130_993515136

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 993515130 993515136
Species Human (GRCh38) Human (GRCh38)
Location 5:88822854-88822876 5:88822884-88822906
Sequence CCATGATCCATATGAGATGGTTG GCAGTACTATAATTTCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108} {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!