ID: 993516411_993516416

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 993516411 993516416
Species Human (GRCh38) Human (GRCh38)
Location 5:88841249-88841271 5:88841264-88841286
Sequence CCTGCACTCCCTGAACTTTGGGA CTTTGGGAGGCTGAGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 310, 3: 15213, 4: 322416} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!