ID: 993521234_993521248

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 993521234 993521248
Species Human (GRCh38) Human (GRCh38)
Location 5:88904264-88904286 5:88904297-88904319
Sequence CCCTCCCCCCTCCCGACCCCCTA TCCAATGGAAAATATCCAATCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 456, 4: 9830} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!