ID: 993521936_993521940

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 993521936 993521940
Species Human (GRCh38) Human (GRCh38)
Location 5:88913707-88913729 5:88913755-88913777
Sequence CCTCTTCTCAGTGTCAGGAAAAC TGTCTGAGTCAGTGCTTATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!