ID: 993590951_993590954

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 993590951 993590954
Species Human (GRCh38) Human (GRCh38)
Location 5:89794663-89794685 5:89794676-89794698
Sequence CCCGCCACTGACTTCCATCCCTC TCCATCCCTCCAGATCCAAAAGG
Strand - +
Off-target summary {0: 32, 1: 92, 2: 135, 3: 160, 4: 426} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!