ID: 993590952_993590956

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 993590952 993590956
Species Human (GRCh38) Human (GRCh38)
Location 5:89794664-89794686 5:89794677-89794699
Sequence CCGCCACTGACTTCCATCCCTCC CCATCCCTCCAGATCCAAAAGGG
Strand - +
Off-target summary {0: 15, 1: 77, 2: 95, 3: 156, 4: 636} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!