ID: 993654623_993654631

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 993654623 993654631
Species Human (GRCh38) Human (GRCh38)
Location 5:90562413-90562435 5:90562435-90562457
Sequence CCCAGCTCTGTTGCCCTGAGTGA AGGTGTGGCAGAGGAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 363} {0: 1, 1: 0, 2: 11, 3: 144, 4: 1265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!