|
Left Crispr |
Right Crispr |
| Crispr ID |
993685237 |
993685242 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:90929302-90929324
|
5:90929336-90929358
|
| Sequence |
CCTCCGAGCCAGGTGCGGGATAT |
GCGTCGTGTTTTAAGCCGGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 494, 1: 1487, 2: 1828, 3: 1188, 4: 779} |
{0: 1, 1: 1, 2: 47, 3: 478, 4: 682} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|