ID: 993698352_993698357

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 993698352 993698357
Species Human (GRCh38) Human (GRCh38)
Location 5:91089078-91089100 5:91089096-91089118
Sequence CCCTGCCACACCTGTGGGTATTG TATTGTGCCATTGTTTAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 265, 4: 645} {0: 1, 1: 0, 2: 1, 3: 40, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!