ID: 993901162_993901174

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 993901162 993901174
Species Human (GRCh38) Human (GRCh38)
Location 5:93584945-93584967 5:93584971-93584993
Sequence CCCCTCCCAGCGCGCCCGCGCGC GCGGCCCTCGGCGAGCAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 396} {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!