ID: 993901203_993901216

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 993901203 993901216
Species Human (GRCh38) Human (GRCh38)
Location 5:93585081-93585103 5:93585105-93585127
Sequence CCCGGCGGCCCCAACCCCGCAGC CAGGCGGCCCGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 384} {0: 1, 1: 2, 2: 9, 3: 105, 4: 577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!