ID: 993907222_993907225

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 993907222 993907225
Species Human (GRCh38) Human (GRCh38)
Location 5:93636490-93636512 5:93636524-93636546
Sequence CCTTCTTCCCTGTGAAGACACAG CTGTCTATGAAAAAGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 112, 3: 666, 4: 1947} {0: 1, 1: 2, 2: 17, 3: 137, 4: 761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!